View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6888_low_4 (Length: 381)

Name: NF6888_low_4
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6888_low_4
NF6888_low_4
[»] chr6 (1 HSPs)
chr6 (188-252)||(10826323-10826387)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 188 - 252
Target Start/End: Original strand, 10826323 - 10826387
Alignment:
188 gttgtggttgttcgtctgtcatctcgtctttctactccttttcttcgcgtttacatctctctatt 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10826323 gttgtggttgttcgtctgtcatctcgtctttctactccttttcttcgcgtttacatctctctatt 10826387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University