View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6888_low_8 (Length: 288)
Name: NF6888_low_8
Description: NF6888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6888_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 41561318 - 41561598
Alignment:
| Q |
1 |
cacgatatttggcttgaaaatatgcgaaataaatggccaaactgtaagcacgaggaaatttaagtacagattgaaaagcaaaagtagtgtttatggtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41561318 |
cacgatatttggcttgaaaatatgcgaaataaatggccaaactgtaagcacgaggaaatttaagtacagattgaaaagcaaaagtagtgtttatggtaag |
41561417 |
T |
|
| Q |
101 |
ctatatattcccgttgtcatttggatcaaggaagctgaaatgcggccatgttattgtcagagttgagagcagctataattccgtggctattgttgagtta |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41561418 |
ctatatattcccattgtcatttggatcaaggaagttgaaatgctgccatgttattgtcagagttgagagcagctataatttcgtggctattgttgagtta |
41561517 |
T |
|
| Q |
201 |
ttcttttaagttttggtctctgtctatagttgataaaattatccagtgttagattttatatttgtttgaacacaggttctg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41561518 |
ttcttttaagttttggtctctgtctatagttgataaaattattcagtgttagattttatatttgtttgaacacaggttctg |
41561598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University