View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6890_high_17 (Length: 254)
Name: NF6890_high_17
Description: NF6890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6890_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 3 - 239
Target Start/End: Complemental strand, 30243659 - 30243422
Alignment:
| Q |
3 |
acatcggtgggcgggtggttctattaaatttggttttcggggtcattccaaacttttacatgtctttcctaaaattgtcgaaaagtgtgttgattaaagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
30243659 |
acatcggtgggcgggtggttctattaaatttggttttcggggtcattccaaacttttacatgtctttactaaaaatgtcgaaaagtgtgttgattaaagt |
30243560 |
T |
 |
| Q |
103 |
tgtcatgcttcaaaggaaatttttgtggggaggtttgatggggaagaagaaaatatgttgggttaaatggtgcgacgtttgtagaccg-aaagaaatgtt |
201 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
30243559 |
tgttatgcttcaaaggaaatttttgtggggaggtttgttggggaagaagaaaatatgttgggttaagtggtgcgacgtttgtagaccgaaaagaagtgtt |
30243460 |
T |
 |
| Q |
202 |
gccttgctcataagagacgatgcacttatcactttatt |
239 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
30243459 |
gccttgttcataagagacaatgcacttatcactttatt |
30243422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University