View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6890_low_26 (Length: 252)
Name: NF6890_low_26
Description: NF6890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6890_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 26 - 228
Target Start/End: Complemental strand, 46290293 - 46290091
Alignment:
| Q |
26 |
gtaattcaaatcaagaaaagaacttatgatattttgttacttnnnnnnnnnnnnnncttatgatattttgttgtatccaatgattttaaatgaaatgtat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46290293 |
gtaattcaaatcaagaaaagaacttatgatattttgttccttaaaaaaaagaaaaacttatgatattttattgtatccaatgattttaaatgaaatgtat |
46290194 |
T |
 |
| Q |
126 |
taggagtaaatttgcttttgctaaaaacaaaactatccattaacctcttgaattaaagttaagggaaatgataacttgtgctttagggtataagttaaga |
225 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
46290193 |
taggagtaaatttgcttttgcttaaaaaaaaactatccattaacctcttgaattaaagttaagggaaataataacttgtgctttggggcataagttaaga |
46290094 |
T |
 |
| Q |
226 |
aga |
228 |
Q |
| |
|
||| |
|
|
| T |
46290093 |
aga |
46290091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University