View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6891_low_1 (Length: 283)
Name: NF6891_low_1
Description: NF6891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6891_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 15 - 275
Target Start/End: Original strand, 47579926 - 47580186
Alignment:
| Q |
15 |
aacattcactggacttggtctctatcatcttggttttcctatggtataaattcctacttatgcaacttttcattcaaagggcttaaactcttgtatccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47579926 |
aacattcactggacttggtctctatcatcttggttttcctatggtataaattcctacttatgcaacttttcattcaaagggcttgcactcttgtatccat |
47580025 |
T |
|
| Q |
115 |
gttaaatttttcatgcaattcagcttctataagtttaggacttgaggatatataggattatattgtatgattcttcccctttaatttttccaatcactgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47580026 |
gttaaatttttcatgcaattcagcttctataagtttaggacttgaggatatataggattatattgtatgattcttcccctttaatttttccaatcactgt |
47580125 |
T |
|
| Q |
215 |
tgcagctggcaacttgtattgaagttgggcttccggcacttattgctatggttttcatctc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47580126 |
tgcagctggcaacttgtattgaagttgggcttccggcacttattgttatggttttcatctc |
47580186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 8683718 - 8683762
Alignment:
| Q |
15 |
aacattcactggacttggtctctatcatcttggttttcctatggt |
59 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
8683718 |
aacattcgctggacttggtctctatcaacttggttttccaatggt |
8683762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University