View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6891_low_3 (Length: 256)
Name: NF6891_low_3
Description: NF6891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6891_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 25 - 252
Target Start/End: Complemental strand, 39364099 - 39363872
Alignment:
| Q |
25 |
atatgatttatctcctcttcctgcaagccacaacacaataagaaaattaactagtacgaagaaattagttttgatttttaacacatgctttattagcatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39364099 |
atatgatttatctcctcttcctgcaagccacaacacaataagaaaattaactagtacgaagaaattagttttgattttgaacacatgctttattagcatt |
39364000 |
T |
|
| Q |
125 |
gataaggctaaattagtaccatgtctgataactctggaaagaccagaattcatatggaacactgcttcttcgtatatctgaaattcattcatcctttctt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39363999 |
gataaggctaaattagtaccatgtccgataactctggaaagaccagaattcatatggaacactgcttcttcgtatatctgaaattcattcatcctttctt |
39363900 |
T |
|
| Q |
225 |
atttctccaaatggcttctttgtttctt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39363899 |
atttctccaaatggcttctttgtttctt |
39363872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 39362586 - 39362537
Alignment:
| Q |
22 |
gccatatgatttatctcctcttcctgcaagccacaacacaataagaaaat |
71 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
39362586 |
gccatatggtttatctcctcttcctgcaagtcacaacacaagaagaaaat |
39362537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University