View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6892_high_14 (Length: 237)
Name: NF6892_high_14
Description: NF6892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6892_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 4 - 123
Target Start/End: Original strand, 14539924 - 14540043
Alignment:
| Q |
4 |
taatgtctttcttacatcccttaggtgtaactttaaccaaaattacgtcagtccatcgtaattttgacaacatcatcgtcaatccaaacatgcactgaac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539924 |
taatgtctttcttacatcccttaggtgtaactttaaccaaaattacgtcagtccatcgtaattttgacaacatcatcgtcaatccaaacatgcactgaac |
14540023 |
T |
|
| Q |
104 |
attcatcaggtcgcaaccac |
123 |
Q |
| |
|
|||||| |||| |||||||| |
|
|
| T |
14540024 |
attcattaggttgcaaccac |
14540043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 14540086 - 14540144
Alignment:
| Q |
165 |
ttaaggagagtaatctaacatgggaacatcatgagggttagttgaattagagttggaac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14540086 |
ttaaggagagtaatctaacatgggaacatcatgaggattagttgaattagagttggaac |
14540144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University