View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6892_low_22 (Length: 281)
Name: NF6892_low_22
Description: NF6892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6892_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 3566852 - 3566594
Alignment:
| Q |
19 |
tattcaacaccattggcaggcaaatgaactaaagcatttctgtcgatccaagacttaaactcttccataggtgacctcgtaggagtgattcttcacctat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3566852 |
tattcaacaccattggcaggcaaatgaactaaagcatttctgtcgatacaagacttaaactcttccataggtgacctggtaggagtgattcttcacctat |
3566753 |
T |
|
| Q |
119 |
gctcatgagctccaataatagagttaaaatcacatatgaagcaccatgggaaggcatattgagattgcaaaagagat-nnnnnnnttccataattgtctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3566752 |
gctcatgagctccaataatagagttaaaatcacatatgaagcaccatgggaaggcatattgagattgcaaaagagataaaaaaaattccataattgtctt |
3566653 |
T |
|
| Q |
218 |
ctttttctgtaatctgtggaagcatacacaacagatataacaaaagtttgatgtccatc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3566652 |
ctttttctgtaatctgtggaagcatacacaacagatataacaaaagtttggtgtccatc |
3566594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University