View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6894_high_8 (Length: 229)
Name: NF6894_high_8
Description: NF6894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6894_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 90 - 223
Target Start/End: Complemental strand, 2939414 - 2939281
Alignment:
| Q |
90 |
cgtatatgtaacattagaatagcatactcaaatttgtctaggttttgttgatcctaagtatattcaaacgttgcatgcaattatatataggctatagcca |
189 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939414 |
cgtatatgtaacattagaatagcattctcaaatttgtctaggttttgttgatcctaagtatattcaaacgttgcatgcaattatatataggctatagcca |
2939315 |
T |
|
| Q |
190 |
ttgaaggagttctatttcgatctcttgaagtttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2939314 |
ttgaaggagttctatttcgatctcttgaagtttt |
2939281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University