View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6894_low_12 (Length: 225)
Name: NF6894_low_12
Description: NF6894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6894_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 20 - 152
Target Start/End: Original strand, 1794313 - 1794448
Alignment:
| Q |
20 |
attcaactcttaaatgcattttaccatttttctcttt---ttaatgaaccaagaatcaagaatgctcacctttcatgacttcagttgtttttctatagac |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794313 |
attcaactcttaaatgcatattaccatttgtctctttatattaatgaaccaagaataaagaatggtcacctttcatgacttcagttgtttttctatagac |
1794412 |
T |
|
| Q |
117 |
aaatgttactttggttattctacaatgtatatgaat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1794413 |
aaatgttactttggttattctacaatgtatgtgaat |
1794448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 146 - 220
Target Start/End: Original strand, 1794508 - 1794582
Alignment:
| Q |
146 |
tatgaatttctattgtgttgtttacaagaaaagtatggaaacatataatagattttgtgaatgtttctaaattcg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1794508 |
tatgaatttctattgtgttgtttacaagaaaagtatggaaacatataatagattcattgaatgtttctaaattcg |
1794582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University