View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6894_low_3 (Length: 295)
Name: NF6894_low_3
Description: NF6894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6894_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 48955465 - 48955200
Alignment:
| Q |
18 |
aatattagtttgttatcatcattatcattaaaaaacagaaagcgttacttttgatgaaaacacattctagaattttcttggttgatgaaagtaaattata |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955465 |
aatattagtttgttatcatcattattattaaaaaacagaaagcgtttcttttgatgaaaacacactctagaattttcttggttgatgaaagtaaattata |
48955366 |
T |
|
| Q |
118 |
gatttattagcatatgtagcataacagcttaggaagattcacgttatataggacggtcctgttaaaactttcctctcaccgttatcatattcatgatact |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48955365 |
gatt-attagcatatgtagcataacaacttaggaagattcacgttatataggacggtcctgttaaaacattcctctcaccgttatcatattcatgatact |
48955267 |
T |
|
| Q |
218 |
gatttcatatttagccccttccatattttatatgattcttgataattctaacgtggttcactttcat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955266 |
gatttcatatttagccccttccatattttatatgattcttgataattctaacgtggttcactttcat |
48955200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University