View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6894_low_7 (Length: 273)
Name: NF6894_low_7
Description: NF6894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6894_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 100 - 256
Target Start/End: Complemental strand, 12820897 - 12820742
Alignment:
| Q |
100 |
gcacgttcagtttccagtgtcataacttttccactgaatcatctactagaaaacccctcattgatcactgtggacagcgactgttacaaacgactcgagt |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
12820897 |
gcacgttcagtttccagtgtcgtaacttttccactgaatcgtctactagaaaacccctcattgatcaccgtcgacagcgactgttacaaac-actcgagt |
12820799 |
T |
 |
| Q |
200 |
ttaataacttcacccgaatggttggttcatgtaatggattgctatgtttgtttggta |
256 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12820798 |
ttaataatttcacccgaatggttggttcatgtaatggattgctatgtttgtttggta |
12820742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University