View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6894_low_8 (Length: 247)
Name: NF6894_low_8
Description: NF6894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6894_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 2939591 - 2939711
Alignment:
| Q |
1 |
tttgttgccatttaataatcgatgcctcaaaaatgagttatgtatggaagttagttttaatttgaggcacaatttaaggaagttactactgtca-ttttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2939591 |
tttgttgccatttaataatcgatgcctcaaaaatgagttatgtatggaagttagttttaatttgaggcacaatttaaggaagttactactgtcatttttt |
2939690 |
T |
 |
| Q |
100 |
cttggttaaattcaagcggtg |
120 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2939691 |
cttggttaaattcaagcggtg |
2939711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 238
Target Start/End: Original strand, 2939792 - 2939827
Alignment:
| Q |
203 |
gggtcagttttggtacatagaatttcatattatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939792 |
gggtcagttttggtacatagaatttcatattatatt |
2939827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University