View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6895_high_10 (Length: 212)
Name: NF6895_high_10
Description: NF6895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6895_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 38730711 - 38730539
Alignment:
| Q |
21 |
tatctacatgtaacatcccgaaactactaaatcattttattattagaaaaaagtatctcaaacactatttatttaaccttgtcaccatagaagaatacat |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
38730711 |
tatctacacgtaacatcccgaaactactaaatcattttattattagaaaaaagtatctcaaacac--ttcatttaaccttgt-------gaagaatacat |
38730621 |
T |
 |
| Q |
121 |
tcatcttatatttacatcaattctaagttttcgtttgnnnnnnnnncctcactcttttcacgtgtttgtgtcatattgatgtcca |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38730620 |
tcatct--tatttacatcaattctaagtttttgtttg-ttttttttcctcactcttttcatgtgtttgtgtcatattgatgtcca |
38730539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University