View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6895_high_7 (Length: 244)
Name: NF6895_high_7
Description: NF6895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6895_high_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 75 - 244
Target Start/End: Complemental strand, 26657174 - 26657001
Alignment:
| Q |
75 |
tagagcagtaaataacatccgaggaatggaaaatgatatgtcaagaaaaagattaatggaacagaaacagcaaaagaacaaggagatagag----agaac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26657174 |
tagagcagtaaataacatccgaggaatggaaaatgatatgtcaagaaaaagattaatagaacagaaacagcaaaagaacaaggagatagagagaaagaac |
26657075 |
T |
 |
| Q |
171 |
caataatgtaactaacaaggctttccagcatattaaccttcaataaatggaaacactcttatgacagctatgag |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26657074 |
caataatgtaactaacaaggctttccagcatattaaccttcaataaatggaaacactcttatgacagctatgag |
26657001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University