View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_high_4 (Length: 324)
Name: NF6897_high_4
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 312
Target Start/End: Original strand, 5036919 - 5037213
Alignment:
| Q |
18 |
aattgctggtgtaaaaccatgcacacataaacatgttataaaaccaaaccatttgctttatgaaattatgacttattggagcttcagggccatcaacatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5036919 |
aattgctggtgtaaaaccatgcacacataaacatgttataaaaccaaaccatttgctttatgaaattatgacttattggagcttcagggccatcaacatc |
5037018 |
T |
|
| Q |
118 |
agataggaactagagtatgagtgctgtgtagttcagacagagcagtacacttacgcaacagggatggggtaacacttcaaaaccatgttactgatattta |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5037019 |
agaaaggaactagagtatgagtgctgtgtagttcagacagagcagtacacttacgcaacagggatggggtaacacttcaaaaccatgttactgatattta |
5037118 |
T |
|
| Q |
218 |
cagcacnnnnnnngttgagaaaaaaggttatgggaattggaatcacaattccttttcttccagtggtccctaataaagcttttcagttctgttct |
312 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5037119 |
cagcacaaaaaaagttgagaaaaaaggttatgggaattggaatcacaattccttttcttccagtggtccctaacaaagcttttcagttctgttct |
5037213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University