View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_high_8 (Length: 229)
Name: NF6897_high_8
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 7139902 - 7139981
Alignment:
| Q |
30 |
taaaaactaaccttgaaagtaccagatacaagtccagataaatccgccaatccaccttctttagaagccattgctccacc |
109 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7139902 |
taaaaactaaccttgaaagcaccagaaacaagaccagaaaaatccgccaatccaccttctttagaagccatagctccacc |
7139981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University