View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_low_10 (Length: 241)
Name: NF6897_low_10
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 48818774 - 48818891
Alignment:
| Q |
107 |
gtgaactgtttctttaacaggaaattggtgtcggcgtgttcttgttgacaaaggtgagttatggtataaagttttgacagatatgaggtagaaagtgggc |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48818774 |
gtgaactgtttctttaacaagaaattggtgtcggcgtgttcttgttgacaaaggtgagttatggtataaagttttgacaaatatgaggtagaaagtgggt |
48818873 |
T |
|
| Q |
207 |
gcattagggagcggttca |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48818874 |
gcattagggagcggttca |
48818891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 48818664 - 48818744
Alignment:
| Q |
1 |
ttgatataaaatatttaaagaatgtatcggaggcac----tagtaagatcttttcaaatatctttaagagaaaggcacatgg |
78 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48818664 |
ttgatataaaatatttaaagaatgcatcggaggcactagttagtaagatcttttcaaatatc-ttaagagaaaggcacatgg |
48818744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University