View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_low_14 (Length: 220)
Name: NF6897_low_14
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 70 - 209
Target Start/End: Complemental strand, 3112822 - 3112681
Alignment:
| Q |
70 |
acagatgttaataggaatctaactagttaaaccatacatttaggtgtggaatattttctgtcaatnnnnnnn--ggtgtggaatattaaactacacatta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3112822 |
acagatgttaataggaatctaactagttaaaccatacatttaggtgtggaatattttctgtcaaaaaaaaaaaaggtgtggaatattaaactacacatta |
3112723 |
T |
 |
| Q |
168 |
cagtttctgctttcagttttatttaacaacctcttcatctca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3112722 |
cagtttctgctttcagttttatttaacaacctctttatctca |
3112681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University