View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_low_16 (Length: 214)
Name: NF6897_low_16
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 28666773 - 28666952
Alignment:
| Q |
20 |
aacaatggaatacataacgacatatagtaggagaagaataaggtagtgtcttagtacaaactcaatttgaaagaagaatgtctgctagggtttcgccggc |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28666773 |
aacaatggaacacataacgacatatagtaggagaagaataaggtagtgtcttagtacaaactcaatttgaaagaaggatgtctgctagggtttcgtcggc |
28666872 |
T |
|
| Q |
120 |
tgagcagctatgttttgctccgttccgaccgtttctctgcttgctcgtggctcctcctcaccttatctcagtcacagtga |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28666873 |
tgagcaactatgttttgctccgttccgaccgtttctctgcttgctcgtggctcctcctcaccttatctctgtcacagtga |
28666952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University