View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6897_low_9 (Length: 248)
Name: NF6897_low_9
Description: NF6897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6897_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 38 - 208
Target Start/End: Original strand, 7139193 - 7139363
Alignment:
| Q |
38 |
aaaaagaaaaccacatctgtcatctgtcaatatgtaccatcagcataataaattgacacacgcacacatccttcactatgtagcactaacacttcagatt |
137 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7139193 |
aaaaagaaaaccacatctgtcatctatcaatctgtaccatcagcataataaattgacacacgcacacatccttcactatgtagcactaacacttcagatt |
7139292 |
T |
 |
| Q |
138 |
gaaagcatgtttgatgtcggtgtgggttcaaacaccggatcaaaactacacgtgtagttatattcaatcac |
208 |
Q |
| |
|
|||||||||||||||||| |||| ||||| || |||||||| | |||||| | ||||||||||||||||| |
|
|
| T |
7139293 |
gaaagcatgtttgatgtctgtgtcggttctaagaccggatcgacactacatgcatagttatattcaatcac |
7139363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University