View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6899_high_13 (Length: 228)
Name: NF6899_high_13
Description: NF6899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6899_high_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 3508930 - 3508703
Alignment:
| Q |
1 |
tcaacttgagcgtcgagaggatattccccgtgattcatttcttttggagaataattatcgagtttatgatcgaaggaatgtggctgctacttctcatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3508930 |
tcaacttgagcgtcgagaggatattccccgtgattcatttcttttggagaataattatcgagtttatgatcgaaggaatgtggctgctacttctcatgtt |
3508831 |
T |
|
| Q |
101 |
aatcttgtaagggaaccttatgagagagattatgaacaccgtctcgtggaacctcactaccaaagcaatgtccccgttcatgttgaaagttttcgaaggg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3508830 |
aatcctgtaagggaaccttatgagagagattatgaaaaccgtctcgtggaacctcgctaccaaagcaatgtccccgttcatgttaaaagttttagaaggg |
3508731 |
T |
|
| Q |
201 |
atcccatttatatgaatgaccgtgaaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3508730 |
atcccatttatatgaatgaccgtgaaca |
3508703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University