View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6899_low_12 (Length: 393)
Name: NF6899_low_12
Description: NF6899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6899_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 158 - 382
Target Start/End: Complemental strand, 50352810 - 50352586
Alignment:
| Q |
158 |
gtggaactcagttctaaaaagtatctctgtggagtgttgccttactcgcgtaagattgtcgcaaaagtatttccttgggggagaaagagaagcacatgtt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50352810 |
gtggaactcagttctaaaaagtatctctgtggagtgttgccttactcgcgtaagattgtcgcaaaagtatttccttggaggagaaagagaagcacatgtt |
50352711 |
T |
|
| Q |
258 |
tttcatgtgtaatgccgcaaatgaggtgtggaaagaggtggattatgggaaaccatcaaaccnnnnnnnatttagaggttagaacttagatcgtttcaac |
357 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50352710 |
tttcatgtgtaatgccgcaaatgaggtgcggaaagaggtggattatgggaaaccatcaaacctttttttatttagaggttagaacttagatcgtttcaac |
50352611 |
T |
|
| Q |
358 |
caatctgtttttgcaatgatgtcca |
382 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
50352610 |
caatctgtttttgcaatgatgtcca |
50352586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 50361300 - 50361160
Alignment:
| Q |
18 |
atcaatatgaatgggaaacccctattatagccttaatatgagccgcagcaggtatgcattttcacatgttttagctactactactactcaatgagtaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50361300 |
atcaatatgaatgggaaacccctattatagccttaatatgagccgcagcaggtatgcattttcacatgttttagctactac---tactcaatgagtaatc |
50361204 |
T |
|
| Q |
118 |
tgacaaaaaatgtaatgataaatagtctgcataattaattgtgg |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50361203 |
tgacaaaaaaggtaatgataaatagtctgcataattaattgtgg |
50361160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University