View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6899_low_20 (Length: 304)
Name: NF6899_low_20
Description: NF6899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6899_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 3 - 301
Target Start/End: Original strand, 3508401 - 3508699
Alignment:
| Q |
3 |
aagagtaacgagatgaaactcgtaaaggcgaggcttccaacttgtctccgcgatatggctgcatttgatggtaatcaggtaaagcatcagcagcagaata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3508401 |
aagagtaacgagatgaaactcgtaaaggcgaggcttccaacttgtctccgcgatatggctgcatttgatggtaatcaggtaaagcatcagcagcagaata |
3508500 |
T |
|
| Q |
103 |
tattgagtaatgcctatcttcaacgatctctctccttcgcaagttatcagtcttggcaaaaggtcttcccccaaccaaatacgagctgggagcgatggca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3508501 |
tattgagtaatgcctatcttcaacgatctctctccttcgcaagttatcagtctcggcaaaaggtcttcccccaaccaaatacgagctgggagcgacggcc |
3508600 |
T |
|
| Q |
203 |
tctctccttaaaggagccaagtatgcatccctagatgaagcaccatattgataggcataacgatcatctatatggtcaggaacagcacgagtatagctc |
301 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3508601 |
tctctccttaaaggagccaagtattcatccctagatgaagcaccatattgataggcataacgatcatttatatggtcaggaacaacacgagtatagctc |
3508699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University