View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6899_low_33 (Length: 234)

Name: NF6899_low_33
Description: NF6899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6899_low_33
NF6899_low_33
[»] chr2 (1 HSPs)
chr2 (17-219)||(4924103-4924305)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 4924305 - 4924103
Alignment:
17 aattatttgttatgcagttgaatcaagagaaagtacataaagatgagaaaagattattgcctgatttgcaactaggtttgagtcacacatatggaaacaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4924305 aattatttgttatgcagttgaatcaagagaaagtacataaagatgagaaaagattattgcctgatttgcaactaggtttgagtcacatatatggaaacaa 4924206  T
117 tgatggtaagattgatcattgcagagagaccaaggaaattagcacaaagttatcactttcttagaattcatgttgctacaagataaacaaatacacgatt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4924205 tgatggtaagattgatcattgcagagagaccaaggaaattagcacaaagttatcactttcttagaattcatgttgctacaagataaacaaatacacgatt 4924106  T
217 cat 219  Q
    |||    
4924105 cat 4924103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University