View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_high_25 (Length: 299)
Name: NF6900_high_25
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 44858955 - 44859222
Alignment:
| Q |
18 |
cagagcaatgaataatccgcagtatgacctctctaccaaacgctcaacgcgtaattgctctagcctaaagcttgtatcatagataaacatattgatggtg |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858955 |
cagagcaatgaataatccgcaatatgacctctctaccaaacgctcaacgcgtaattgctctagcctaaagcttgtatcatagataaacatattgatggtg |
44859054 |
T |
|
| Q |
118 |
acatataagtaatagaagccagcaatggaggactattggcaacatcagctggtagttttaccagtagccttcgcctggacagccttgtagcattggagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44859055 |
acatataagtaatagaagccagcaatggaggactattggcaacatcagctggtagttttaccagtagccttcgcctggacagccttgtagcattggagac |
44859154 |
T |
|
| Q |
218 |
tgcaaagaggaaccttggtttttgaatcccggtatttatacggatttgtacatgatggaccagcacag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44859155 |
tgcaaagaggaaccttggtttttgaatcccggtatttatacggatttgtacatgatggaccagcacag |
44859222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University