View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_high_35 (Length: 234)
Name: NF6900_high_35
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 9209567 - 9209359
Alignment:
| Q |
9 |
gagtgagaagaagaatcatcacagagagagaattgagatagaaaaggagtgaattcacttcataaatcatccatttcttggtttcacattcccctctcaa |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9209567 |
gagtgagaagaagaatca---cagagagagaattgggatagaaaaggagtgaattcacttcataaatcatccattccttggtttcacattcccctctcaa |
9209471 |
T |
 |
| Q |
109 |
ttcaaacaatctctcagccatgagtttattagctttgcctttgcccacctctcacctcctaattttcatgacttcctctaacctacttttgattccttgt |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9209470 |
ttcaaacaatctctcagccatgagt---ttagctttgcctttgcccacctctcacctcctaattttcatgacttcctctagcctaattttgattccttgt |
9209374 |
T |
 |
| Q |
209 |
aattgtcttgatgtc |
223 |
Q |
| |
|
||||| |||| |||| |
|
|
| T |
9209373 |
aattgccttgctgtc |
9209359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University