View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_14 (Length: 497)
Name: NF6900_low_14
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 49496008 - 49496196
Alignment:
| Q |
20 |
gaaatgatatgattcaattggggtactattatttatggtctcatgtcgtgacataatctcgtagctttgacaaagtggatgtgaaaactgaaaaaata-- |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49496008 |
gaaatgatatgattcaattggggtactattatttatggtctcatgtcgtgacataatctcgtagctttgacaa-gtggatgtgaaaactgaaaaaatata |
49496106 |
T |
 |
| Q |
118 |
agtagaggtgattgacatgaacaaattaaactgagacaaatctctattaatatgataattctactagaaccgttcattctaagaattaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496107 |
agtagaggtgattgacatgaacaaattaaactgagacaaatctatattaatatgataattctactagaaccgttcattctaagaattaaa |
49496196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University