View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_28 (Length: 358)
Name: NF6900_low_28
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 30138542 - 30138191
Alignment:
| Q |
1 |
tgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138542 |
tgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccaca |
30138443 |
T |
 |
| Q |
101 |
ggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138442 |
ggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaa |
30138343 |
T |
 |
| Q |
201 |
gttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138342 |
gttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttt |
30138243 |
T |
 |
| Q |
301 |
tggttgtttaggttcagccattatctcttctttcatttaccatattcttcga |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30138242 |
tggttgtttaggttcagccattatctcttctttcatttaccatatgcttcga |
30138191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University