View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6900_low_45 (Length: 299)

Name: NF6900_low_45
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6900_low_45
NF6900_low_45
[»] chr7 (1 HSPs)
chr7 (18-285)||(44858955-44859222)


Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 44858955 - 44859222
Alignment:
18 cagagcaatgaataatccgcagtatgacctctctaccaaacgctcaacgcgtaattgctctagcctaaagcttgtatcatagataaacatattgatggtg 117  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44858955 cagagcaatgaataatccgcaatatgacctctctaccaaacgctcaacgcgtaattgctctagcctaaagcttgtatcatagataaacatattgatggtg 44859054  T
118 acatataagtaatagaagccagcaatggaggactattggcaacatcagctggtagttttaccagtagccttcgcctggacagccttgtagcattggagac 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44859055 acatataagtaatagaagccagcaatggaggactattggcaacatcagctggtagttttaccagtagccttcgcctggacagccttgtagcattggagac 44859154  T
218 tgcaaagaggaaccttggtttttgaatcccggtatttatacggatttgtacatgatggaccagcacag 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44859155 tgcaaagaggaaccttggtttttgaatcccggtatttatacggatttgtacatgatggaccagcacag 44859222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University