View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_51 (Length: 268)
Name: NF6900_low_51
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 31590128 - 31589867
Alignment:
| Q |
1 |
tgccttctgactctattctctcagtgacgagcagtagattttctgattggcaggaaacaaagtggtacgcaacaggccatcagagtggtgctgtcaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31590128 |
tgccttctgactctattctctcagtgacgagcagtagattttctgattggcaggaaacaaagtggtacgcaacaggccatcagagtggtgctgtcaaagt |
31590029 |
T |
 |
| Q |
101 |
gtggcaaatggttcactgctctgacccagatagctctctcagcaaatcaggtgcaggtgggttcagagtgttaaaccttggtgcaaaagagccagaatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31590028 |
gtggcaaatggttcactgctctgacccagatagctctctcagcaaatcaggtgcaagtgggttcagagtgttaaaccttggtgcaaaagagccagaatac |
31589929 |
T |
 |
| Q |
201 |
agattgatcctacgcaaggtactcaagttccataagcatccggttactgctcttcatctcac |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589928 |
agattgatcctacgcaaggtactcaagttccataagcatccggttactgctcttcatctcac |
31589867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University