View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_53 (Length: 256)
Name: NF6900_low_53
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 47583771 - 47584012
Alignment:
| Q |
1 |
aaccctttgttctccatcatttatgctaaacaataaaatgctcaaatattgt-agaaaaatcctgtgtttgtaatagagtttgatactagagtctttctg |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583771 |
aaccctttgttctccatcattgatgctaaacaataaaatgctcaaatattgttagaaaaatcctgtgtttgtaatagagtttgatactagagtctttctg |
47583870 |
T |
 |
| Q |
100 |
ttttgaaagagaagtattcaaacatatgctccgaataaaactatacttatggattaattggttatccttaagaaattaaaatttacatgatcattatctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47583871 |
ttttgaaagagaagtattcaaacatatgctccgaataaaactatacttatggattaattggttatccttaagaaatgaaaatttacatgatcattatctt |
47583970 |
T |
 |
| Q |
200 |
gatctctctatttatgtagatggtctctctttgaatcaaaat |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47583971 |
gatctctctatttatgtacatggtctctctttgaatcaaaat |
47584012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University