View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_62 (Length: 239)
Name: NF6900_low_62
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_62 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 25965665 - 25965871
Alignment:
| Q |
20 |
catcttttcaagtgtataataaataaaatgcagtgcaagtccacacaatcttaactagtttataaaaacacgtcaccttgcatattcgcaaatatgacca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25965665 |
catcttttcaagtgtataataaataaaatgctgtgcaagtccacacaatcttaactagtttataaaaacacgtcaccttgcatattcgcaaatatgacca |
25965764 |
T |
|
| Q |
120 |
gcggccgtgaacaagaagcaaatcttcaaggtaacggaattgtgcaatggcaaaatcactagccatcacagcttgcattccctccattccacttatgcca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25965765 |
gcggccgtgaacaagaagcaaatcttcaaggtaacggaattgtgcaatggcaaaatcactagccatcacagcttgcattccctccattccacttatgcca |
25965864 |
T |
|
| Q |
220 |
acaccaa |
226 |
Q |
| |
|
||||||| |
|
|
| T |
25965865 |
acaccaa |
25965871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 93 - 226
Target Start/End: Original strand, 16237620 - 16237753
Alignment:
| Q |
93 |
caccttgcatattcgcaaatatgaccagcggccgtgaacaagaagcaaatcttcaaggtaacggaattgtgcaatggcaaaatcactagccatcacagct |
192 |
Q |
| |
|
||||| ||||||||| | ||||||||| ||||| ||||||||||| |||||| |||||||||| || |||||||| ||||||||||||||||| || ||| |
|
|
| T |
16237620 |
cacctggcatattcgaagatatgaccaccggccatgaacaagaagtaaatctgcaaggtaacgaaactgtgcaattgcaaaatcactagccattactgct |
16237719 |
T |
|
| Q |
193 |
tgcattccctccattccacttatgccaacaccaa |
226 |
Q |
| |
|
||||| |||||||| || ||||| |||||||||| |
|
|
| T |
16237720 |
tgcataccctccatcccgcttattccaacaccaa |
16237753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University