View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_64 (Length: 237)
Name: NF6900_low_64
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 38678867 - 38679083
Alignment:
| Q |
12 |
acatcaaagttataaaaatatttcctggatatttcagttatgtgaacttatgatacaatatttgttcttggataggtgaaatttttgcttgattgggaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38678867 |
acatcaaagttataaaaatatttcctggatatttcagttatgtgaaattatgatacaatatttgttcttggataggtgaaatttttgcttgattgggaaa |
38678966 |
T |
|
| Q |
112 |
aaggattgcaggattatgcttctggtggaatttacaactggaatatattagagcctggatctagttttgtatggtctacgattagatcatttgagcctcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38678967 |
--ggattgcaggattatgcttctggtggaatttacaactggaatatattagagcctggatctagttttgtatggtctacgattagatcatttgagcctcc |
38679064 |
T |
|
| Q |
212 |
acactctcacatatagatt |
230 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
38679065 |
acaatctcacatatagatt |
38679083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University