View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6900_low_69 (Length: 221)
Name: NF6900_low_69
Description: NF6900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6900_low_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 36095199 - 36095067
Alignment:
| Q |
1 |
ttgctcttttaggtaagtatggttctttattgttaacgtatataaatctgttttgtttgtgtctgtgagagagagagttctcttactctatcttgggctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36095199 |
ttgctcttttaggtaagtatggttctttattgttaacgtatataaatctgttttgtttgtgtctgtgagagagagagttctcttactctattttgggctt |
36095100 |
T |
|
| Q |
101 |
gagtcttgaatatattctagtgatagaagggga |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36095099 |
gagtcttgaatatattctagtgatagaagggga |
36095067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University