View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6902_low_12 (Length: 231)
Name: NF6902_low_12
Description: NF6902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6902_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 13298720 - 13298577
Alignment:
| Q |
1 |
ttgtatggatactgaacctattttgttgcacctcgatgaactagtcttcgtgaaccaacctttctatctttttcttgcttttagaggcaaggg-tcgtcc |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
13298720 |
ttgtatggatactgaacttattttgttgcacctcgatgaactagtcttcttgaaccaacctttctatctttttcttgcttttagaggcaagggctcgtac |
13298621 |
T |
 |
| Q |
100 |
tcgtggtcatcattatcaagaaatttcgacttcaggcgggcatc |
143 |
Q |
| |
|
|| ||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
13298620 |
tcatggtcatcattatcaagaaattttggcttcaggcgggcatc |
13298577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University