View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6902_low_2 (Length: 309)
Name: NF6902_low_2
Description: NF6902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6902_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 137 - 296
Target Start/End: Original strand, 48448443 - 48448602
Alignment:
| Q |
137 |
atctggtttcgaattgagaaaacatgagtcactatgacacttctaatggaagctgcgtcgggtgtcgtcactgatacatttcattgcattcaattaattc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48448443 |
atctggtttcgaattgagaaaacatgagtcactatgacacttctaatggaagccgcgtcgggtgtcgtcactgacacatttcattgcattcaattaattc |
48448542 |
T |
 |
| Q |
237 |
attttttcaaaatttgatccgtgctgacgtgtcctgtcagtgtgtccggtgtctgtgtct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48448543 |
attttttcaaaatttgatccgtgctgacgtgtcctgtcagtgtgtccggtgtctgtgtct |
48448602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University