View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6902_low_7 (Length: 300)
Name: NF6902_low_7
Description: NF6902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6902_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 108 - 285
Target Start/End: Original strand, 9920802 - 9920981
Alignment:
| Q |
108 |
tccttttactagttaacataagagaatatagatcaaacatttccctcactaacaaaaaactactaataaaattacaaattg-nnnnnnnnnnnttgaatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9920802 |
tccttttactagttaacataagagaatatagatcaaacatttccctcactaacaaaaaactactaataaaattacaaattgaaaaaaaaaaatttgaatt |
9920901 |
T |
 |
| Q |
207 |
tacaatt-aaagaaccaataaaatgagtgccactgagattgaagtgatcatcacctgagagaaaatgggtctgttgattt |
285 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9920902 |
tacaattaaaaaaaccaataaaatgagtgccactgagattgaagtgatcatcacctgagagaaaatgggtttgttgattt |
9920981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 9920700 - 9920742
Alignment:
| Q |
9 |
agcagagatcaatcccaatattgaattaccatcaatttacccc |
51 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9920700 |
agcaaagatcaatcccaatattgaattaccatcaatttacccc |
9920742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University