View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6903_low_20 (Length: 213)
Name: NF6903_low_20
Description: NF6903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6903_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 48713513 - 48713710
Alignment:
| Q |
1 |
gaagccagtggctagtgttgaattagtactatgatcacacgttatatgcaaaaattcagtgtagttaaatccatttttaactggaactcctatcttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| || ||||| ||||| |||| |
|
|
| T |
48713513 |
gaagccagtggctagtgttgaattagtactatgatcacgcgttatatgcaaaaattcagtgtagttatctccatttttcaccggaacccctattctcaat |
48713612 |
T |
|
| Q |
101 |
ttcttaccaatagtaggaatttcccatccctttggaatagagttcatatcccctggccacatgattaatccaagatcatttttagaagtagaatatat |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48713613 |
ttcttcccaatagtaggaatttcccatccctttggaatagagttcatatcccctggccacatgattaatccaagatcatttttagaagtagaatatat |
48713710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 48701407 - 48701589
Alignment:
| Q |
1 |
gaagccagtggctagtgttgaattagtactatgatcacacgttatatgcaaaaattcagtgtagttaaatccatttttaactggaactcctatcttcaac |
100 |
Q |
| |
|
||||||||||||| |||||||||| |||||| ||||| | |||| | ||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48701407 |
gaagccagtggcttgtgttgaattggtactaggatcatatgttactttcaagaattcagtgtagttaaatccatttttaactggaactcctatcctcaac |
48701506 |
T |
|
| Q |
101 |
ttcttaccaatagtaggaatttcccatccctttggaatagagttcatatcccctggccacatgattaatccaagatcattttt |
183 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||| |||||| | |||||| ||||||| |
|
|
| T |
48701507 |
ttcttaccaatggtaggaatttccgatccctttggaatagagtacatatcccctggccatatgattgacccaagaacattttt |
48701589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University