View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6904_high_4 (Length: 240)
Name: NF6904_high_4
Description: NF6904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6904_high_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 39729722 - 39729500
Alignment:
| Q |
19 |
tcaaggatatggcacacaaggtcaccaacaaccacagccaggtcgtggagctggtgccacagaggcaccaactctttctggtgctaatgtttcctctgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39729722 |
tcaaggatatggcacacaaggtcaccaacaaccacagccaggtcgtggagctggtgccacagaggcaccaactctttctggtgctaatgtttcctctgag |
39729623 |
T |
 |
| Q |
119 |
gctaaattcaatgctgctaatgctgttaatagcaaaggagttccataatttgctttatatatgataagaaattgtt-ttttagttttgctttccatttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39729622 |
gctaaattcaatgctgctaatgctgttaatagcaaaggagttccataatttgctttatatatgataagaaattgtttttttagttttgctttccatttgt |
39729523 |
T |
 |
| Q |
218 |
aaaattatcttttgagagttttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39729522 |
aaaattatcttttgagagttttt |
39729500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 35175741 - 35175624
Alignment:
| Q |
19 |
tcaaggatatggcacacaaggtcaccaacaaccacagccaggtcgtggagctggtgccacagaggcaccaactctttctggtgctaatgtttcctctgag |
118 |
Q |
| |
|
|||||| ||||| || |||||||| ||||||||| |||| ||||||||| |||||||||| |||||| | ||||||||||||||||||||||||||| | |
|
|
| T |
35175741 |
tcaaggttatggtactcaaggtcatcaacaaccaaagcctggtcgtggacctggtgccactgaggcagctactctttctggtgctaatgtttcctctcaa |
35175642 |
T |
 |
| Q |
119 |
gctaaattcaatgctgct |
136 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
35175641 |
gcccaattcaatgctgct |
35175624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University