View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6904_low_3 (Length: 300)
Name: NF6904_low_3
Description: NF6904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6904_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 290
Target Start/End: Complemental strand, 50822653 - 50822370
Alignment:
| Q |
9 |
gaacctgtgtgtcatgcatgctcattgtgttatcttatcgtttgaaatttaatttaagctataatttcttttgagattcttggcattgtgttttgaaaag |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50822653 |
gaacgtgtgtgtcatgcatgctcattgtgttatcttatcgtttgaaatttaatttaagctataatttcttttgagattcttggcattgtgttttgaaaaa |
50822554 |
T |
 |
| Q |
109 |
tgtgttttatgcttaaattcgagagaagctggatgataagtttcatcactagactaagaaatctgtgttatttacact-----gttgatgataagtttaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50822553 |
tgtgttttatgcttaaattcgagagaagctg---gataagtttcatcactagactaagaaatctgtgttatttacactacttagttgatgataagtttaa |
50822457 |
T |
 |
| Q |
204 |
taactagcatacaccgacacatctataccggtaataatttgggaaaatagaaacaatttattttaactacatgtgtagtgtcggtgc |
290 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50822456 |
taactagcatacacctacacatctataccggtaataatttgggaaaatagaaacaatttattttaactacatgtgtagtgtcagtgc |
50822370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University