View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6906_high_2 (Length: 366)
Name: NF6906_high_2
Description: NF6906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6906_high_2 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 29096228 - 29096576
Alignment:
| Q |
1 |
ggattagtttctctcaaaacatcactagcttgaacacgatcaaaatttgacatttcttttattgtcatgttcatgaggttatgacaattgcgagcctttg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29096228 |
ggattagtttctctcagaacatcactagcttgaacacgatcaaaattcgacatttcttttattgtcatgttcatgaggttattacaattgcgagcctttg |
29096327 |
T |
 |
| Q |
101 |
tacaaccactattgataaagtctttctttgaaaagatcggatcaattcaccaaaattgacaccgagaagaatcaaacacgagattttgagagaaacacac |
200 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||| |||| ||||||||| ||||||| | |
|
|
| T |
29096328 |
tataaccactgttgataaagtctttctttgaaaaggtcaaatcaattcaccaaaattgacaccgagaaaaatcgtacacaagattttgaaagaaacatag |
29096427 |
T |
 |
| Q |
201 |
tgcaaggtctcaaaccaacaccatcataccattatttgtaaagttaattgctaacaatgaattagactaaagcatcaatgctctactccctttctccttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29096428 |
tgcaaggtctcaaaccaacaccatcatatcattatttgtaaagttaattgctaacaatgaattagactaaaacatcaatgctctactccctttctccttt |
29096527 |
T |
 |
| Q |
301 |
gttatttgtaaaatgaaaatatttcatcaacactcatacacccatttga |
349 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29096528 |
gttatttgtaaaatgaaaatatttcatgaacactcatacacccatttga |
29096576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 231
Target Start/End: Original strand, 29511 - 29574
Alignment:
| Q |
168 |
agaatcaaacacgagattttgagagaaacacactgcaaggtctcaaaccaacaccatcatacca |
231 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| ||| ||||||| | ||||||| ||||||| |
|
|
| T |
29511 |
agaatcaaacatgagactttgagagaaacacactccaaagtctcaagcgaacaccaccatacca |
29574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 223
Target Start/End: Original strand, 25414194 - 25414269
Alignment:
| Q |
148 |
caccaaaattgacaccgagaagaatcaaacacgagattttgagagaaacacactgcaaggtctcaaaccaacacca |
223 |
Q |
| |
|
||||||||||| ||||| | |||||||||| |||| |||||||| | |||||| ||||||||||| ||||||||| |
|
|
| T |
25414194 |
caccaaaattggcaccggggagaatcaaacctgagactttgagaggagcacactccaaggtctcaagccaacacca |
25414269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 226
Target Start/End: Complemental strand, 47183418 - 47183340
Alignment:
| Q |
148 |
caccaaaattgacaccgagaagaatcaaacacgagattttgagagaaacacactgcaaggtctcaaaccaacaccatca |
226 |
Q |
| |
|
|||| |||||||||||| ||| |||| ||| ||||| ||||||| | |||||| ||||||||||| |||||||||||| |
|
|
| T |
47183418 |
caccgaaattgacaccgggaaaaatcgaacctgagatcttgagaggatcacactccaaggtctcaagccaacaccatca |
47183340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 20094205 - 20094164
Alignment:
| Q |
153 |
aaattgacaccgagaagaatcaaacacgagattttgagagaa |
194 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
20094205 |
aaattgacaccgggaagaatcaaacatgagattttgggagaa |
20094164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 201
Target Start/End: Original strand, 38990588 - 38990648
Alignment:
| Q |
141 |
atcaattcaccaaaattgacaccgagaagaatcaaacacgagattttgagagaaacacact |
201 |
Q |
| |
|
|||||| || |||||||||||||| |||||| |||| ||||| |||||||||||||||| |
|
|
| T |
38990588 |
atcaatccatcaaaattgacaccggagagaatcgaacatgagatcttgagagaaacacact |
38990648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University