View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6906_low_7 (Length: 292)
Name: NF6906_low_7
Description: NF6906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6906_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 33266067 - 33266323
Alignment:
| Q |
17 |
agttatataagtaatttatcagtacttttgcttggaattggaacccactcaggtgttgttggtgatcacagatgacacactttgtgggagggaacattaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33266067 |
agttatataagtaatttatcagtacttttgcttggaattggaacccactcaggtgttgttggtgatcacaaatgacacactttgtgggagggaacattaa |
33266166 |
T |
 |
| Q |
117 |
aatgaaatgtcatctttttggttggtgtaatttcttgttctaaatgtgttaaacatggtcattaagttgttgtgaatgatgatagttatgtatgtaagtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33266167 |
aatgaaatgtcatctttttggttggtgtaatttcttgttctaaatgtgttaaacagggtcattaagttgttgtgaatgatgatagttatgtatgtaagtt |
33266266 |
T |
 |
| Q |
217 |
tttcatagttttatattctattgagacatgcaaatcccacttttttcttttgatatt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33266267 |
tttcatagttttatattctattgagacatgcaaatcccacttttttcttttgatatt |
33266323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University