View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6907_low_9 (Length: 319)
Name: NF6907_low_9
Description: NF6907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6907_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 9339867 - 9339559
Alignment:
| Q |
1 |
attaggtgtttgggatggaataccaacactggatgtagaaccgggtcgggatgaagaccatggttgatcgtcagcaaaagaagacccattatagtcaaat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339867 |
attaggtgtttgggaaggaataccaacactggatgtagaaccgggtcgggatgaagaccatggttgatcgtcagcaaaagaagacccattatagtcaaat |
9339768 |
T |
|
| Q |
101 |
gaatttacatcaacttttaggtttcttccaatggcatcagatggttctgactgattaaccatgttactatcagaacctaaccctgtgttaactctcagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339767 |
gaatttacatcaacttttaggtttcttccaatggcatcagatggttctgactgattaaccatgttactatcagaacctaaccctgtgttaactctcagat |
9339668 |
T |
|
| Q |
201 |
gaggcataacgtcaccaagttcttgaaaaggagatccttctggggcatctgacgagcgaacaggcaagtcgatcccnnnnnnnccttgttcaaaccacaa |
300 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
9339667 |
gaggcataatgtcaccaagttcttgaaaaggagatccttctggggcatctgaagagcgaacaagcaagtcgatcccaaaaaaaccttgttcaaaccacaa |
9339568 |
T |
|
| Q |
301 |
aatgatgtc |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
9339567 |
aatgatgtc |
9339559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University