View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6908_high_4 (Length: 403)
Name: NF6908_high_4
Description: NF6908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6908_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 16 - 398
Target Start/End: Complemental strand, 49301778 - 49301396
Alignment:
| Q |
16 |
caaaatggacagtgacacaaaatcattattcgtaaatattgtgtcgtggaagcgttcaattaaaatataatgcagggttttaaaaaatgttttcgagcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301778 |
caaaatggacagtgacacaaaatcattattcgtaaatattgtgtcgtggaagcgttcaattaaaatataatgcagggttttaaaaaatgttttcgagcac |
49301679 |
T |
 |
| Q |
116 |
aatcaaggctacgacattaaggnnnnnnnnnnnnnnnnnngcaacctcaacatcaatctgcatttgaccgtagttattcgcaatgttaaggattgcggta |
215 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49301678 |
aatcaaggctgcgacattaaggtttttattttatttttttgcaacctcgacatcaatctgcatttgaccgttgttattcgcaatgttaaggattgcggta |
49301579 |
T |
 |
| Q |
216 |
tgaccgcgattaaaatgatggcataccttcaaattggaattcatgtattttgcttctttgtttaatttgatgattttttcgggagcatcttcttttattg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301578 |
tgaccgcgattaaaatgatggcataccttcaaattggaattcatgtattttgcttctttgtttaatttgatgattttttcgggagcatcttcttttattg |
49301479 |
T |
 |
| Q |
316 |
cttgcttctcaataaaccaaggtgtaagttcatccctcacctcttctggcattttggagaggcgtcttgttttgatgtccatc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
49301478 |
cttgcttctcaataaaccaaggtgtaagttcatccctcacctcttctggcattttggagaggcgtcttgttttgctgttcatc |
49301396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University