View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_high_15 (Length: 231)
Name: NF6909_high_15
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 52656268 - 52656490
Alignment:
| Q |
1 |
aacctcaggttcctatgcatatttcttaaaaacaacaaaagtatatt-gtatttagaaatagaaaggannnnnnnggtacattattgggctattatattg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52656268 |
aacctcaggttcctatgcatatttcttaaaaacaacaaaagtatatttgtatttagaaatagaaaggatttttttggtacattattgggctattatattg |
52656367 |
T |
|
| Q |
100 |
ttggtaactaaccggtcaccaaatgttgctgaatatgttgaactactagggtgctttatttgcaactttattttattcatcattgacttgtttcaggacg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52656368 |
ttggtaactaaccagtcaccaaatgttactgaatatgttgaactactagggtgctttatttgcaactttattttattcatcattgacttgtttcaggacg |
52656467 |
T |
|
| Q |
200 |
tttctgaatcattatgttttgat |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52656468 |
tttctgaatcattatgttttgat |
52656490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University