View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_high_5 (Length: 375)
Name: NF6909_high_5
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 9 - 211
Target Start/End: Original strand, 12676332 - 12676534
Alignment:
| Q |
9 |
ggacatcaaaataaaacagagcaagtaaatcataaccgacggattcaatcaattaaagtcacattattttgaatatctcataagatacgtacgacattaa |
108 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
12676332 |
ggacattaaaataaaacatagcaagtaaatcataaccgacggattcaatcaattaaagtcacattattttgaatatctcataagatacgtactatattaa |
12676431 |
T |
|
| Q |
109 |
aagtgatccaatcatcattaaaaatgatgtaagcaaataacaaacatttagtctagattnnnnnnnnnntacagaattactccatagagttcacatatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12676432 |
aagtgatccaatcatcattaaaaatgatgtaagcaaataacaaacttttagtctagattaaaaaaaatatacagaattactccatagagttcacatatat |
12676531 |
T |
|
| Q |
209 |
ccg |
211 |
Q |
| |
|
||| |
|
|
| T |
12676532 |
ccg |
12676534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University