View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_low_21 (Length: 284)
Name: NF6909_low_21
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 284
Target Start/End: Complemental strand, 12199072 - 12198861
Alignment:
| Q |
72 |
tttttaagaggaagagtcatgttaccaactctctcaacattatattggtttgacgcttaattttctaatgtttcaaataaaaactatacaaaaataagag |
171 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12199072 |
tttttatgaggaagagtcatgttaccaactctctcaatattatgttggtttgacgcttaattttctaatgtttcaaataaaaactatacaaaaataggag |
12198973 |
T |
|
| Q |
172 |
ttgtgaatatggccttggggctgcaaaccaactagtttaactcgcggcccaaggtggagaaagaccaatatgtttcacaccatttttgttttggttcaca |
271 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12198972 |
ttgtgaatatggcc-cggggctgcaaaccaactagtttaactcgcggcccaaggtggataaagaccaatatgtttcacaccattttcgttttggttcaca |
12198874 |
T |
|
| Q |
272 |
taaggtggattgc |
284 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12198873 |
taaggtggattgc |
12198861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University