View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_low_27 (Length: 253)
Name: NF6909_low_27
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 34 - 241
Target Start/End: Original strand, 17832665 - 17832872
Alignment:
| Q |
34 |
ggaaatctgatgtggtttcctgggtattttcagcatgtaaactgtttgcagcaaagttttctgatggtacaatacttcagcagagcataaaggcatgcat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17832665 |
ggaaatctgatgtggtttcctgggtattttcagcatgtaaactgtttgcagcaaagttttctgatggtacaatactgcagcagagcataaaggcatgcat |
17832764 |
T |
|
| Q |
134 |
tttgttcctagattttgatcaatctctgcgtaatctttcatagtttctattaaaactattttcatactttttgtggtgttgtctttctttcttttgagtt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17832765 |
tttgttcctagattttgatcaatctctgcgtaatctttcatagtttctattaaaactattttcatactttttgtggtgttgtctttctttcttttgagtt |
17832864 |
T |
|
| Q |
234 |
atgatgtc |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
17832865 |
atgatgtc |
17832872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University