View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_low_28 (Length: 250)
Name: NF6909_low_28
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 12198589 - 12198670
Alignment:
| Q |
10 |
aagaatataatgaagttgagatatattcatatgagtgtctgctgtgttggtctatggttatttagattttagactattttgc |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12198589 |
aagaaaataatgaagttgagatatattcatatgagtgtctgatgtgttggtctatggttatttagattttagactattttgc |
12198670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 175 - 250
Target Start/End: Original strand, 12198751 - 12198826
Alignment:
| Q |
175 |
tattttataattttatgttttatagtgttggttgtaaatccggaagtaagaaaaaacccataaacatcacatacaa |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
12198751 |
tattttataattttatgttttaaagtgttggttgtaaataccaaagtaagaaaaaactcataaacatcacatacaa |
12198826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University